DLG5 (3 of 4)

Ensembl ID:
ENSDARG00000090949
Description:
discs, large homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:2904]
Human Orthologue:
DLG5
Human Description:
discs, large homolog 5 (Drosophila) [Source:HGNC Symbol;Acc:2904]
Mouse Orthologue:
Dlg5
Mouse Description:
discs, large homolog 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918478]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44778 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125331 Nonsense 369 534 7 8
Genomic Location (Zv9):
Chromosome 12 (position 50287533)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48900903
GRCz11 12 48854226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATTTATTTGAGCCTCTTATGTGTTGTTCTGCAGGTTTGAGAGTGTT[C/T]AGCAGGAGCTGAATAAGCTGTCGGTCCACAACGAGGATCTACAGAGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link