zgc:165555

Ensembl ID:
ENSDARG00000090941
ZFIN IDs:
ZDB-GENE-030131-5068, ZDB-GENE-030131-5087, ZDB-GENE-060929-1050, ZDB-GENE-070424-79, ZDB-GENE-070620-17, ZDB-GENE-070927-10
Description:
histone cluster 1, H4-like [Source:RefSeq peptide;Acc:NP_001092231]
Human Orthologues:
HIST1H4A, HIST1H4C, HIST1H4E, HIST1H4I, HIST1H4J, HIST1H4L, HIST4H4
Human Descriptions:
histone cluster 1, H4a [Source:HGNC Symbol;Acc:4781]
histone cluster 1, H4c [Source:HGNC Symbol;Acc:4787]
histone cluster 1, H4e [Source:HGNC Symbol;Acc:4790]
histone cluster 1, H4i [Source:HGNC Symbol;Acc:4793]
histone cluster 1, H4j [Source:HGNC Symbol;Acc:4785]
histone cluster 1, H4l [Source:HGNC Symbol;Acc:4791]
histone cluster 4, H4 [Source:HGNC Symbol;Acc:20510]
Mouse Orthologues:
AC125099.1, Hist1h4a, Hist1h4c, Hist1h4f, Hist1h4m
Mouse Descriptions:
histone cluster 1, H4a Gene [Source:MGI Symbol;Acc:MGI:2448419]
histone cluster 1, H4c Gene [Source:MGI Symbol;Acc:MGI:2448421]
histone cluster 1, H4f Gene [Source:MGI Symbol;Acc:MGI:2448425]
histone cluster 1, H4m Gene [Source:MGI Symbol;Acc:MGI:2448441]
histone H4 [Source:RefSeq peptide;Acc:NP_783583]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38138 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123892 Nonsense 56 103 1 1
Genomic Location (Zv9):
Chromosome 25 (position 36187161)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34620901
GRCz11 25 35125859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCCGTGGTGGAGTCAAGCGTATTTCTGGTCTGATCTACGAGGAGACA[A/T]GAGGTGTTCTCAAAGTGTTCTTGGAGAACGTGATCCGTGATGCCGTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
  • Pubertal anthropometrics: Genome-wide association and longitudinal analyses reveal genetic loci linking pubertal height growth, pubertal timing and childhood adiposity. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link