zgc:193725

Ensembl ID:
ENSDARG00000090912
ZFIN IDs:
ZDB-GENE-021206-13, ZDB-GENE-080723-11
Description:
Epididymal secretory protein E1 [Source:UniProtKB/Swiss-Prot;Acc:Q9DGJ3]
Human Orthologue:
NPC2
Human Description:
Niemann-Pick disease, type C2 [Source:HGNC Symbol;Acc:14537]
Mouse Orthologue:
Npc2
Mouse Description:
Niemann Pick type C2 Gene [Source:MGI Symbol;Acc:MGI:1915213]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23159 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002945 Nonsense 105 149 3 4
ENSDART00000050399   None 149 None 5
ENSDART00000124663   None 149 None 4
ENSDART00000132754   None 149 None 4
ENSDART00000139875   None 149 None 5
ENSDART00000140551   None 149 None 5
Genomic Location (Zv9):
Chromosome 17 (position 43066703)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43031378
GRCz11 17 43021916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTGACGATGGGTGCAAATCTGGGATTCAGTGTCCGATTGTTCCACAG[A/T]AACCTTACAACTACGTCACCGAGCTGCCAGTCAAGACTGAGTATCCAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link