
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000090910
- Ensembl ID:
- ENSDARG00000090910
- Human Orthologue:
- ZBED4
- Human Description:
- zinc finger, BED-type containing 4 [Source:HGNC Symbol;Acc:20721]
- Mouse Orthologue:
- Zbed4
- Mouse Description:
- zinc finger, BED domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2682302]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18679 | Nonsense | Available for shipment | Available now |
sa42086 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18679
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125040 | Nonsense | 64 | 528 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 38941144)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 37228558 GRCz11 12 37403300 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATCTTTTYTGTTCTTWTAGGGAGAAAGTTTCTCCATGGCAGGCCTTTTT[T/A]ACRTGTCCAAACAAACCAACAARCCCAGCCTCATATTCAACAAGAATTCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42086
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125040 | Nonsense | 175 | 528 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 12 (position 38941565)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 37228979 GRCz11 12 37403721 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGACTGTGGCCGGTCACCTAATCAATGAAAACTGGGAACTGAAATCATA[T/A]GTGCTCGATACGGCACATTTAATCCACAAAAGCACAGCTGAAAGTGTTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: