
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NLRP6 (16 of 83)
- Ensembl ID:
- ENSDARG00000090901
- Description:
- NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
- Human Orthologue:
- NLRP6
- Human Description:
- NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
- Mouse Orthologue:
- Nlrp6
- Mouse Description:
- NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33335 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33335
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130740 | Nonsense | 5 | 994 | 1 | 14 |
- Genomic Location (Zv9):
- Chromosome 3 (position 59071311)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 58147986 GRCz11 3 58203510 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTGTTCAGAGTCAAAGAGCAGCACAAAACCATCATGAAGATCAAGTA[C/A]GAGAGCTTATTTGAGGGAGTGAAACTCCAGCAGAATCAAACCCTCCTGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: