KNDC1 (2 of 2)

Ensembl ID:
ENSDARG00000090897
Description:
kinase non-catalytic C-lobe domain (KIND) containing 1 [Source:HGNC Symbol;Acc:29374]
Human Orthologue:
KNDC1
Human Description:
kinase non-catalytic C-lobe domain (KIND) containing 1 [Source:HGNC Symbol;Acc:29374]
Mouse Orthologue:
Kndc1
Mouse Description:
kinase non-catalytic C-lobe domain (KIND) containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923734]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19387 Nonsense Mutation detected in F1 DNA During 2018
sa44436 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38228 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127770 Nonsense 101 507 4 12
Genomic Location (Zv9):
Chromosome Zv9_NA97 (position 31217)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50416399
GRCz11 13 50731308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGAGATGTTTCCTCCACAACCGTCTGTCGAAAGCTGTCTGCTATTGGA[C/T]GAAGAGTTTTGTCCATCGAGTCTGTCGCTGCTTTCCAAGGTTTGATTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127770 Essential Splice Site 412 507 9 12
Genomic Location (Zv9):
Chromosome Zv9_NA97 (position 37468)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50410148
GRCz11 13 50725057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTCTTGGCTCCTGAATTTCAAGAACATGGAATTGTGACAGAAAAGG[T/C]TTGTCACCATGGCAGCCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127770 Nonsense 456 507 10 12
Genomic Location (Zv9):
Chromosome Zv9_NA97 (position 38684)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50408952
GRCz11 13 50723861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGAGGCTGAAGCGGCTGCTGCTGGAGATGGCCAAGCGGACCCCCATC[G/T]AGAGACCTTCCATCCAGACCGCCAAGAAGGTGCTGTGTTTTATGTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link