
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-113k9.1
- Ensembl ID:
- ENSDARG00000090883
- ZFIN ID:
- ZDB-GENE-091204-365
- Human Orthologue:
- GABRA3
- Human Description:
- gamma-aminobutyric acid (GABA) A receptor, alpha 3 [Source:HGNC Symbol;Acc:4077]
- Mouse Orthologue:
- Gabra3
- Mouse Description:
- gamma-aminobutyric acid (GABA) A receptor, subunit alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95615]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10277 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa10277
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122393 | Nonsense | 266 | 294 | 7 | 7 |
ENSDART00000142810 | None | 51 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 21 (position 43145915)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 44456995 GRCz11 21 44451592 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATATTTCCATTTGAAAAGGAAAATTGGCTATTTCGTGATCCAGAYGTA[T/A]CTGCCCTGCATAATGACCGTCATATTATCTCAGGTCTCCTTCTGGCTGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: