wu:fq41a10

Ensembl ID:
ENSDARG00000090872
ZFIN ID:
ZDB-GENE-060720-44
Human Orthologue:
C7orf57
Human Description:
chromosome 7 open reading frame 57 [Source:HGNC Symbol;Acc:22247]
Mouse Orthologue:
Gm11992
Mouse Description:
predicted gene 11992 Gene [Source:MGI Symbol;Acc:MGI:3651127]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40650 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121822 Nonsense 185 220 6 7
Genomic Location (Zv9):
Chromosome 6 (position 12214462)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12067684
GRCz11 6 12302542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCCCATGATAAGAAGGAGGCAGCTCCGGTCAACATGTCCAAACTTT[T/A]AAGCTTTGGTTACGCTCAGGATGAAAATAAATCTCCCAATGATGATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link