wu:fd14g04

Ensembl ID:
ENSDARG00000090870
ZFIN ID:
ZDB-GENE-030131-5362

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43721 Nonsense Mutation detected in F1 DNA During 2018
sa29663 Splice Site Mutation detected in F1 DNA During 2018
sa29662 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9299 Nonsense Mutation detected in F1 DNA During 2018
sa10348 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125534 Nonsense 16 1236 1 11
Genomic Location (Zv9):
Chromosome 21 (position 42042294)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43641340
GRCz11 21 43636516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTATGAATCATTTAGATTATTTTGCAAAGCTCTTTATTTTCTTGCTGT[T/A]GCGTCATTACTGGGTGTGTTATGGTGAGTTACTCTTGTAAGAAAAATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125534 Splice Site None 1236 None 11
Genomic Location (Zv9):
Chromosome 21 (position 42040975)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43640021
GRCz11 21 43635197
KASP Assay ID:
2261-6089.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGAGCCTAGATGCTGATGCAGAATCTAATTCAACTCTGCATGGTAACT[T/G]AAGTCTGGATACTGCTGCAGAATCCAACTCCACCCTAAATGCTAACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125534 Essential Splice Site 207 1236 6 11
Genomic Location (Zv9):
Chromosome 21 (position 42040331)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43639377
GRCz11 21 43634553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCAACTTCAGTCTAGATGCTGCTGCAGAATCCAACTCAACCCTACAAG[G/T]TAACTCTGGCTGGTTGACACTTAAGATTGGAACCATAACTGAAGCCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125534 Nonsense 369 1236 8 11
ENSDART00000125534 Nonsense 369 1236 8 11
Genomic Location (Zv9):
Chromosome 21 (position 42039081)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43638127
GRCz11 21 43633303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGACCCTGTATGATAACTTTAGCCTGGATGATGCTGCGGAATCCAATT[C/A]AACCCTGTATARAAACTTCAGCCTAAATGCTGCAGAATCAAACTCCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125534 Nonsense 369 1236 8 11
ENSDART00000125534 Nonsense 369 1236 8 11
Genomic Location (Zv9):
Chromosome 21 (position 42039081)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43638127
GRCz11 21 43633303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGACCCTGTATGATAACTTTAGCCTGGATGATGCTGCGGAATCCAATT[C/A]AACCCTGTATARAAACTTCAGCCTAAATGCTGCAGAATCAAACTCCACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link