
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000090867
- Ensembl ID:
- ENSDARG00000090867
- Mouse Orthologue:
- Gm7534
- Mouse Description:
- predicted gene 7534 Gene [Source:MGI Symbol;Acc:MGI:3702974]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32728 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa38283 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32728
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126345 | Essential Splice Site | 98 | 1048 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41952111)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 40868528 GRCz11 1 41570450 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAACAAATAAAACAAGTGTACAAACTACAACTTCAACAACAAGTACAA[G/A]TATGTCAAATGTTGAAAAATCTTTGGCAACAACACTGAAGCCTCTAACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38283
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126345 | Nonsense | 677 | 1048 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 1 (position 41954123)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 40870540 GRCz11 1 41572462 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCTAAAATCCTCAACTGTTGAATCAGTATCAACAACTGATGCAGCAAGC[A/T]AAACTACAGCTGAAACCACAGCAACTTCTTGGACAACAACAACAACATCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: