zgc:113361

Ensembl ID:
ENSDARG00000090866
ZFIN ID:
ZDB-GENE-050327-22
Description:
hypothetical protein LOC541499 [Source:RefSeq peptide;Acc:NP_001014334]
Human Orthologue:
KCNJ1
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 1 [Source:HGNC Symbol;Acc:6255]
Mouse Orthologue:
Kcnj1
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 1 Gene [Source:MGI Symbol;Acc:MGI:1927248

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098445 Nonsense 150 370 1 1
ENSDART00000142107 Nonsense 150 370 2 2
Genomic Location (Zv9):
Chromosome 18 (position 47092112)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48533803
GRCz11 18 48528500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCCTGCAGGTGTGGCTCTGATTACAATCCAGATGCTCATAGGACTCT[T/G]AATCAGTATATTCTGGTGTGGTATAGTCATGACCAAAATCACCCTTCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link