Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000090860
- Ensembl ID:
- ENSDARG00000090860
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa19404 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19404
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000129557 | Nonsense | 74 | 149 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 2809380)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150001.1 19900 GRCz11 1 3294940 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTCTGTCAGGGGACTTTAATGGACTGCGAAGAAGTGCGTAAAGTTTTT[C/T]AGTTGAAACAAATCGGACCTGCAAAATCAATACCTGACACGCCGAGAACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
