ZNF518B

Ensembl ID:
ENSDARG00000090832
Description:
zinc finger protein 518B [Source:HGNC Symbol;Acc:29365]
Human Orthologue:
ZNF518B
Human Description:
zinc finger protein 518B [Source:HGNC Symbol;Acc:29365]
Mouse Orthologue:
Zfp518b
Mouse Description:
zinc finger protein 518B Gene [Source:MGI Symbol;Acc:MGI:2140750]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9746 Nonsense Available for shipment Available now
sa22399 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9746
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125592 Nonsense 473 884 1 1
Genomic Location (Zv9):
Chromosome 14 (position 266137)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 292155
GRCz11 14 156189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTGCAAAAGAGTGTCCAGTCGGTACATCAACATCTTCAACATTTCAY[C/T]AAGTCAAACARCAGCAGACTTCMRCAAGCCCTAACACAAAGACTTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125592 Nonsense 731 884 1 1
Genomic Location (Zv9):
Chromosome 14 (position 265363)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 291381
GRCz11 14 155415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCAAGAGGAGCGTCTGACGGCACGGCCGGTTCTCTACTGTACATTA[C/T]GAGAACAGAACGTGTCCGGCAGTCCTGAAGTGGCCATCAAGCTGATATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link