zgc:171517

Ensembl ID:
ENSDARG00000090822
ZFIN ID:
ZDB-GENE-080219-12
Description:
hypothetical protein LOC563255 [Source:RefSeq peptide;Acc:NP_001104643]
Human Orthologue:
QDPR
Human Description:
quinoid dihydropteridine reductase [Source:HGNC Symbol;Acc:9752]
Mouse Orthologue:
Qdpr
Mouse Description:
quinoid dihydropteridine reductase Gene [Source:MGI Symbol;Acc:MGI:97836]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31204 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102542 Essential Splice Site 47 257 2 8
Genomic Location (Zv9):
Chromosome 1 (position 23151757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23686071
GRCz11 1 24376900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGCACTGGGCACAGAGAGTGTGCGCTACTTCAGAGCCAAACATTGG[G/A]TAAGTTGGATTAATTCAGAAGAAAGACTACTTCATTGAAAATAAGTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link