si:ch73-167c12.3

Ensembl ID:
ENSDARG00000090804
ZFIN ID:
ZDB-GENE-100922-89
Human Orthologue:
GPR155
Human Description:
G protein-coupled receptor 155 [Source:HGNC Symbol;Acc:22951]
Mouse Orthologue:
Gpr155
Mouse Description:
G protein-coupled receptor 155 Gene [Source:MGI Symbol;Acc:MGI:1915776]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44700 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126719 Essential Splice Site 694 813 15 18
ENSDART00000147034 Essential Splice Site 706 814 14 16
Genomic Location (Zv9):
Chromosome 9 (position 2485238)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 2501380
GRCz11 9 2551534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTTTTGGCCTCGACAAGCATTTAATCATTTCTCCGTTCAAAAAGAG[G/A]TAACTACATTTCTGCAACACTGGTCACGTGGTGTTGGACTTATCTTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link