zgc:100947

Ensembl ID:
ENSDARG00000090785
ZFIN ID:
ZDB-GENE-040801-144
Description:
hypothetical protein LOC445230 [Source:RefSeq peptide;Acc:NP_001003624]
Human Orthologue:
DIAPH3
Human Description:
diaphanous homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:15480]
Mouse Orthologue:
Diap3
Mouse Description:
diaphanous homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1927222]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44743 Nonsense Mutation detected in F1 DNA During 2018
sa41875 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040305 Nonsense 187 267 5 6
ENSDART00000122218   None 561 None 14
ENSDART00000139900 Nonsense 47 937 2 23
ENSDART00000145497 Nonsense 82 162 3 4
Genomic Location (Zv9):
Chromosome 11 (position 32729818)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31562167
GRCz11 11 31825163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACACCAGAACCACTCTAATATGATGTTTTCTCTTTCTAGCTGGGTG[C/T]AGAGTTTTGGCCATGAGGGTCTGGGTCTCCTGTTGGATACGCTGGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040305   None 267 None 6
ENSDART00000122218 Nonsense 337 561 10 14
ENSDART00000139900 Nonsense 610 937 16 23
ENSDART00000145497   None 162 None 4
Genomic Location (Zv9):
Chromosome 11 (position 32861404)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 31693753
GRCz11 11 31956749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCACTGGTCAAGTACAAGAGTGAATATGCCAACCTCTCAGAACCAGAG[C/T]AGTTTGGAGTCGTGGTAATTTCATGCACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link