zgc:171785

Ensembl ID:
ENSDARG00000090768
ZFIN IDs:
ZDB-GENE-060817-1, ZDB-GENE-060817-1, ZDB-GENE-071004-37, ZDB-GENE-071004-40, ZDB-GENE-071004-54
Description:
hypothetical protein LOC100008088 [Source:RefSeq peptide;Acc:NP_001103212]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36288 Nonsense Mutation detected in F1 DNA During 2018
sa22977 Essential Splice Site Available for shipment Available now
sa22975 Nonsense Available for shipment Available now
sa10207 Essential Splice Site Available for shipment Available now
sa22974 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013506   None 428 None 9
ENSDART00000065821 Nonsense 106 431 1 8
ENSDART00000074181   None 431 None 8
ENSDART00000128797 Nonsense 106 432 1 8
Genomic Location (Zv9):
Chromosome 17 (position 2373146)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2418791
GRCz11 17 2595177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGTTGCTGAAGCCCAGAGAGAGTTTGCCACAAACTTCCAGCTGAAG[C/T]AGCCTGCATCTCCTGGCAGCACTGTTGCGGTTAACTGTGGTTCAGATCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013506   None 428 None 9
ENSDART00000065821 Essential Splice Site 174 431 None 8
ENSDART00000074181   None 431 None 8
ENSDART00000128797 Essential Splice Site 174 432 None 8
Genomic Location (Zv9):
Chromosome 17 (position 2372938)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2418583
GRCz11 17 2594969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTCATCTTTGAGTATGCAACTCAGGACCCTGAGAGTGTTGTGATGG[T/C]AAGAACCTATTTTTGGTGGCTTATTTGTGTTGGGTAAACAAAAGTACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013506 Nonsense 73 428 1 9
ENSDART00000065821   None 431 None 8
ENSDART00000074181   None 431 None 8
ENSDART00000128797   None 432 None 8
Genomic Location (Zv9):
Chromosome 17 (position 2355756)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2401401
GRCz11 17 2577787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAATAGTCTTGACTCTAGGAAACCTGTGCAAGCTCCTCTCGGTCTT[C/T]AGGAGAAGCTGATGCTGCAAGCTCCTGAGCCTTTCACCTGGAAGTTCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10207
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013506 Essential Splice Site 214 428 2 9
ENSDART00000065821   None 431 None 8
ENSDART00000074181   None 431 None 8
ENSDART00000128797 Essential Splice Site 214 432 2 8
Genomic Location (Zv9):
Chromosome 17 (position 2354886)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2400531
GRCz11 17 2576917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCCGGACCAATAGTKCAGTTGTTGGTGTTCARTGCCACTATCCAAGG[T/C]ATGYTATAAAGGCTTCTGWGGTTNNGTTAAACCAGCTTGACTGTTNNCCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013506 Essential Splice Site 308 428 4 9
ENSDART00000065821   None 431 None 8
ENSDART00000074181   None 431 None 8
ENSDART00000128797   None 432 None 8
Genomic Location (Zv9):
Chromosome 17 (position 2354443)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2400088
GRCz11 17 2576474
KASP Assay ID:
2261-0484.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCTGATCCTGAAGCTCTGCCAAGATATTCCTTCATTGAGAATCATGG[G/A]TAAGATCATGCTAACTTTGTCCCTGGTCTGCAATGGTAGGTATATTATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link