wu:fj68a07

Ensembl ID:
ENSDARG00000090751
ZFIN ID:
ZDB-GENE-030131-9399
Human Orthologue:
ZC3H3
Human Description:
zinc finger CCCH-type containing 3 [Source:HGNC Symbol;Acc:28972]
Mouse Orthologues:
Gm7353, Zc3h3
Mouse Descriptions:
predicted pseudogene 7353 Pseudogene [Source:MGI Symbol;Acc:MGI:3643014]
zinc finger CCCH type containing 3 Gene [Source:MGI Symbol;Acc:MGI:2663721]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20731 Essential Splice Site Available for shipment Available now
sa20730 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129803 Essential Splice Site 795 929 9 12
Genomic Location (Zv9):
Chromosome 6 (position 32436786)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32754451
GRCz11 6 32739141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGGTGTGTGAAGACTTTGTGCGAGGCTACTGCCCTCAGGGAGATAAG[G/A]TAAGGCAGTTAGAGGATTTCCATTGCAAAACACGAGTTATTGATTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129803 Nonsense 813 929 10 12
Genomic Location (Zv9):
Chromosome 6 (position 32424097)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 32741762
GRCz11 6 32726452
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGAAACACACGCTGGTATGCCCAGACTTCTCCAGTACTGGTGTGTG[T/A]CCACGTGGTTCCAAATGCAAACTGCACCACAGACAGAGCAAGAAACGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link