Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
C5orf15
- Ensembl ID:
- ENSDARG00000090747
- Description:
- chromosome 5 open reading frame 15 [Source:HGNC Symbol;Acc:20656]
- Human Orthologue:
- C5orf15
- Human Description:
- chromosome 5 open reading frame 15 [Source:HGNC Symbol;Acc:20656]
- Mouse Orthologue:
- 9530068E07Rik
- Mouse Description:
- RIKEN cDNA 9530068E07 gene Gene [Source:MGI Symbol;Acc:MGI:2654705]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa37384 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37384
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000130880 | Nonsense | 5 | 566 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 43895164)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 45147324 GRCz11 21 45188169 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCTGTACTGCGCATGCGGCTCGGTGACGTCAGCAGAAGATGGCTGCGGTG[C/T]GACAGACGCCACTGGAGGACTCAACGATGGTGAAAGTTTTAGTTTTAGTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Attention deficit hyperactivity disorder and conduct disorder: Conduct disorder and ADHD: evaluation of conduct problems as a categorical and quantitative trait in the international multicentre ADHD genetics study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
