zgc:158446

Ensembl ID:
ENSDARG00000090730
ZFIN ID:
ZDB-GENE-030131-2319
Description:
complement factor B [Source:RefSeq peptide;Acc:NP_001077327]
Human Orthologues:
CFB, XXbac-BPG116M5.17
Human Descriptions:
cDNA FLJ55673, highly similar to Complement factor B [Source:UniProtKB/TrEMBL;Acc:B4E1Z4]
complement factor B [Source:HGNC Symbol;Acc:1037]
Mouse Orthologue:
Cfb
Mouse Description:
complement factor B Gene [Source:MGI Symbol;Acc:MGI:105975]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12079 Essential Splice Site Available for shipment Available now
sa9654 Essential Splice Site Available for shipment Available now
sa43662 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6676 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 84 751 3 18
ENSDART00000125911 Essential Splice Site 73 440 2 10
Genomic Location (Zv9):
Chromosome 21 (position 26845229)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27414140
GRCz11 21 27450835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAACACAACMATTTTKTMTGCTGCTCTCAAAWCAATTGCTTTTAYCWC[A/T]GAAATCACTTGTCCGGATCCTCGTGCATTTTTAAACGGAGATGTGCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 204 751 4 18
ENSDART00000125911 Essential Splice Site 193 440 3 10
Genomic Location (Zv9):
Chromosome 21 (position 26845665)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27414576
GRCz11 21 27451271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGYCAGGAYAATGGACAGTGGTCAGGAACAGAGCCACAATGTTACGG[T/C]AAACACCCCTCTCTATGTCTTAAAGGCACAATACGNNNNNNTACGNNTTTTTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Essential Splice Site 235 751 5 18
ENSDART00000125911 Essential Splice Site 224 440 4 10
Genomic Location (Zv9):
Chromosome 21 (position 26846437)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27415348
GRCz11 21 27452043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTCTCTAGTGTCAAACCTACAGCTTACTCAACTGCATGAAGAAACAG[G/A]TAGTCTTGAGCAACTCTCGCAATCTTCCTCCTCTTTAAGATTTTTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100784 Nonsense 395 751 9 18
ENSDART00000125911 Nonsense 384 440 8 10
Genomic Location (Zv9):
Chromosome 21 (position 26849516)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27418427
GRCz11 21 27455122
KASP Assay ID:
554-4699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTGGTAGTCCAAAACCATTGGTGGACAAGATCAAAAGTTTGGTCAGA[C/T]AAAATTCAGTGGAGGAAAAACTTGGTDAGGAAGAACACGAATGATTGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link