zgc:172246

Ensembl ID:
ENSDARG00000090722
ZFIN ID:
ZDB-GENE-030131-1178
Description:
hypothetical protein LOC796447 [Source:RefSeq peptide;Acc:NP_001093526]
Human Orthologue:
C6orf58
Human Description:
chromosome 6 open reading frame 58 [Source:HGNC Symbol;Acc:20960]
Mouse Orthologue:
2310057J18Rik
Mouse Description:
RIKEN cDNA 2310057J18 gene Gene [Source:MGI Symbol;Acc:MGI:1914969]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1814 Missense F2 line generated During 2018

Mutation Details

Allele Name:
sa1814
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064419   None 364 None 6
ENSDART00000126408 Missense 67 364 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 1422243)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 1378108
GRCz11 20 1398934
KASP Assay ID:
554-1806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGGTAAACCCGTGGGTCTACTCCCAGAGGATGACCATGTTGAAAAT[G/T]GTGATCAACGCTACTAATGCCTACATGAGCTCCATGGGCCCCGGGGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link