
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
gaa
- Ensembl ID:
- ENSDARG00000090714
- ZFIN ID:
- ZDB-GENE-070212-2
- Human Orthologue:
- GAA
- Human Description:
- glucosidase, alpha; acid [Source:HGNC Symbol;Acc:4065]
- Mouse Orthologue:
- Gaa
- Mouse Description:
- glucosidase, alpha, acid Gene [Source:MGI Symbol;Acc:MGI:95609]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11797 | Nonsense | Available for shipment | Available now |
sa33128 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11797
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127796 | Nonsense | 525 | 918 | 10 | 19 |
ENSDART00000144222 | None | 290 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18153258)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18274578 GRCz11 3 18424318 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGGGCTCTGTGGATGGATGTCCTGACTCTGAATTGGAGAAACCACCATA[T/A]ACACCAGGTCACAATACWAAASTCTTTTTAGTAGAATACTATCACTNCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33128
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127796 | Nonsense | 719 | 918 | 15 | 19 |
ENSDART00000144222 | Nonsense | 91 | 290 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18157444)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18278764 GRCz11 3 18428504 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTTACTGACATTTGCTCATTTCTTTCAGGTTCCCCACTGATCCAGATTG[C/A]AGGAGCATTGACAGACAGTTCCTGTGGGGGAGTTCACTGCTCATCAGTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: