A5PLI7_DANRE

Ensembl ID:
ENSDARG00000090710
Description:
LOC794117 protein [Source:UniProtKB/TrEMBL;Acc:A5PLI7]
Human Orthologue:
RNF14
Human Description:
ring finger protein 14 [Source:HGNC Symbol;Acc:10058]
Mouse Orthologue:
Rnf14
Mouse Description:
ring finger protein 14 Gene [Source:MGI Symbol;Acc:MGI:1929668]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45527 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121752 Nonsense 329 331 4 4
Genomic Location (Zv9):
Chromosome 15 (position 3640558)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4045792
GRCz11 15 3791513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTTCTGCACCCTCTGCAATCGACTATACCACGCCCTCTCTCTCTG[C/A]ACAAAAAGTAAGACTCCTTTCATACACATAAAAATGATTAAGTCAGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link