
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eif3ea
- Ensembl ID:
- ENSDARG00000090697
- ZFIN ID:
- ZDB-GENE-030131-3827
- Description:
- Eukaryotic translation initiation factor 3 subunit E-A [Source:UniProtKB/Swiss-Prot;Acc:Q6DRI1]
- Human Orthologue:
- EIF3E
- Human Description:
- eukaryotic translation initiation factor 3, subunit E [Source:HGNC Symbol;Acc:3277]
- Mouse Orthologue:
- Eif3e
- Mouse Description:
- eukaryotic translation initiation factor 3, subunit E Gene [Source:MGI Symbol;Acc:MGI:99257]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45584 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22915 | Essential Splice Site | Available for shipment | Available now |
sa4677 | Nonsense | F2 line generated | During 2018 |
sa32103 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa45584
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126705 | Nonsense | 84 | 446 | 3 | 13 |
ENSDART00000140684 | Nonsense | 84 | 109 | 3 | 7 |
ENSDART00000144651 | None | 157 | None | 5 |
The following transcripts of ENSDARG00000090697 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 41291577)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 38676377 GRCz11 16 38626409 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTTGCAGCTCTTCGAGAGAAGAGAACTACAGTAGTGGCTCAACTCAAA[C/T]AACTCCAATCTGAAACGGAGCCAATTGTGAAGGTGTTTGAGGACCCAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22915
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126705 | Essential Splice Site | 200 | 446 | 6 | 13 |
ENSDART00000140684 | Essential Splice Site | None | 109 | 5 | 7 |
ENSDART00000144651 | Essential Splice Site | 58 | 157 | 2 | 5 |
The following transcripts of ENSDARG00000090697 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 41258448)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 38643248 GRCz11 16 38593280 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCTGCCATGGAAGACCTGACCCGCCTGAGGGAGACTATCGATAACAAT[G/T]TAATGCCCCGCCACTCAGAATTCAATACCACATTCGGATTCCCTTACATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4677
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126705 | Nonsense | 251 | 446 | 8 | 13 |
ENSDART00000140684 | None | 109 | 7 | 7 | |
ENSDART00000144651 | Nonsense | 98 | 157 | 4 | 5 |
The following transcripts of ENSDARG00000090697 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 41248050)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 38632850 GRCz11 16 38582882 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTGTTGTTTGTTTTGTTTACAGGTACCTCAATGCTATTCAGACCATGTG[T/A]CCACACATACTGCGCTATCTGACCACAGCCGTCATCACCAACAAGGACGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32103
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126705 | Essential Splice Site | 389 | 446 | 11 | 13 |
ENSDART00000140684 | None | 109 | None | 7 | |
ENSDART00000144651 | None | 157 | None | 5 |
The following transcripts of ENSDARG00000090697 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 41226435)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 38611235 GRCz11 16 38561267 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACCTCATTCGTAATGCCAGGCTGGATGCCAAAATCGACTCCAAACTGG[T/C]GAGAGTCTCTCATATTTTATTTCGCTCTTGTTTCCCTGCCTCCCTCCTCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Dupuytren's disease: Wnt signaling and Dupuytren's disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: