ch1073-321c8.1
- Ensembl ID:
- ENSDARG00000090656
- ZFIN IDs:
- ZDB-GENE-040426-1976, ZDB-GENE-081028-53
- Description:
- translocase of outer mitochondrial membrane 20 homolog a [Source:RefSeq peptide;Acc:NP_998201]
- Human Orthologue:
- ARID4B
- Human Description:
- AT rich interactive domain 4B (RBP1-like) [Source:HGNC Symbol;Acc:15550]
- Mouse Orthologue:
- Arid4b
- Mouse Description:
- AT rich interactive domain 4B (RBP1-like) Gene [Source:MGI Symbol;Acc:MGI:2137512]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa16991 |
Essential Splice Site |
Available for shipment |
Available now |
sa22385 |
Nonsense |
Available for shipment |
Available now |
sa11972 |
Essential Splice Site |
Available for shipment |
Available now |
sa13629 |
Essential Splice Site |
Available for shipment |
Available now |
sa11502 |
Essential Splice Site |
Available for shipment |
Available now |
sa35597 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa16991
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 13 (position 50653193)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
49364981 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CCTGTCATCGGCAARAAGRGAAACCGCGGCGGWCGRCGCTCCAACCCCAT[G/A]TGAGTGCCTGTGYGATTGTGTGTGTGTGTGTGTKTGTGTGTGTGTGTGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22385
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 50646284)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
49358072 |
GRCz11 |
13 |
49648750 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGATGGTATGATTTAATGCATACCGTGTTGTGTTATGTCCTACAGTTA[T/A]ACAGTTTTACGGAAAGATATTCGAGAGTTGGATGAAGATAAAGCTCCCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11972
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 13 (position 50638484)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
49350272 |
GRCz11 |
13 |
49640950 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATCTGTTCAAGCTCTACAGGCTGGTGCATAAGCTGGGAGGATTCGACAAT[G/T]WGAGTGAAACACGGTCTCAATCATTNNNNGGAAAATAAAGATTTAAATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13629
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 13 (position 50638483)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
49350271 |
GRCz11 |
13 |
49640949 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTGTTCAAGCTCTACAGGCTGGTGCATAAGCTGGGAGGATTCGACAATK[T/A]GAGTGAAACACGGTCTCAATCATTNNNNGGAAAATAAAGATTTAAATTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11502
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 13 (position 50638483)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
49350271 |
GRCz11 |
13 |
49640949 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCTGTTCAAGCTCTACAGGCTGGTGCATAAGCTGGGAGGATTCGACAATK[T/A]GAGTGAAACACGGTCTCAATCATTNNNNGGAAAATAAAGATTTAAATTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35597
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 13 (position 50606452)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
13 |
49318240 |
GRCz11 |
13 |
49608918 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTGAGGAGCGGTCGCCCGGCTGTCGCACCAAAGGACAGAAGGACGTTTG[G/A]TCGAGTATTCAGGTTCAGTGGCCCAAGAAAACTCTTAAAGAGCTGTTTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: