ASCC3 (2 of 2)

Ensembl ID:
ENSDARG00000090561
Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Human Orthologue:
ASCC3
Human Description:
activating signal cointegrator 1 complex subunit 3 [Source:HGNC Symbol;Acc:18697]
Mouse Orthologue:
Ascc3
Mouse Description:
activating signal cointegrator 1 complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1925237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36013 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121477 Nonsense 221 605 5 12
Genomic Location (Zv9):
Chromosome 16 (position 2436686)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 1594842
GRCz11 16 1618730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCACGTCTCCATTTTTCCTCTAGGTGGAGTCGACCCAGAGTATGATC[C/T]GAATACTCGGTCTCTCTGCAACGTTGCCAAATTACCTGGACGTGGCGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link