ENSDARG00000090514

Ensembl ID:
ENSDARG00000090514
Human Orthologue:
MYOM2
Human Description:
myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
Mouse Orthologue:
Myom2
Mouse Description:
myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30368 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45869 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130478 Essential Splice Site 165 345 5 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3535 (position 30599)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6842317
GRCz11 13 6970695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATGCTGAGAAAACCCACACTCGTACCCTGGATCTTTCTGGACAACG[T/C]GAGTTGTTTGAATGTGTCACTTCTTAATATGAAGCTTAAGCTTTTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130478 Essential Splice Site 165 345 6 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3535 (position 35681)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6837235
GRCz11 13 6965613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTTCTTAACTTTTATTTATTCGTTCATTCACTTTGTTTCCCCCAT[A/C]GTCTACGACAACGCCTATGCAGAATTCCAGAGACTCAAGTAAGATATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link