
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000090514
- Ensembl ID:
- ENSDARG00000090514
- Human Orthologue:
- MYOM2
- Human Description:
- myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
- Mouse Orthologue:
- Myom2
- Mouse Description:
- myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30368 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa45869 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30368
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130478 | Essential Splice Site | 165 | 345 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3535 (position 30599)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 6842317 GRCz11 13 6970695 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGATGCTGAGAAAACCCACACTCGTACCCTGGATCTTTCTGGACAACG[T/C]GAGTTGTTTGAATGTGTCACTTCTTAATATGAAGCTTAAGCTTTTTAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45869
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130478 | Essential Splice Site | 165 | 345 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3535 (position 35681)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 6837235 GRCz11 13 6965613 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGTGTTCTTAACTTTTATTTATTCGTTCATTCACTTTGTTTCCCCCAT[A/C]GTCTACGACAACGCCTATGCAGAATTCCAGAGACTCAAGTAAGATATCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: