wu:fc54d09

Ensembl ID:
ENSDARG00000090442
ZFIN ID:
ZDB-GENE-030131-3802
Human Orthologue:
TRRAP
Human Description:
transformation/transcription domain-associated protein [Source:HGNC Symbol;Acc:12347]
Mouse Orthologue:
Trrap
Mouse Description:
transformation/transcription domain-associated protein Gene [Source:MGI Symbol;Acc:MGI:2153272]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18006 Nonsense Available for shipment Available now
sa27935 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22073 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17251 Nonsense Available for shipment Available now
sa10196 Nonsense Available for shipment Available now
sa9226 Nonsense Mutation detected in F1 DNA During 2018
sa15065 Essential Splice Site Available for shipment Available now
sa35253 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 685 3852 17 73
Genomic Location (Zv9):
Chromosome 12 (position 18978594)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17831977
GRCz11 12 17953851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCTAACCACATCTGCTCTCTTTGCCACCATCCTGGTGGAGTATCTGT[T/A]GGAGCGTCTGCCTGAAATGGGCTCCAATGTGGAGTTATCAAACCTKTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 779 3852 18 73
Genomic Location (Zv9):
Chromosome 12 (position 18980875)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17834257
GRCz11 12 17956131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCTCCTGTACCAGGAGTTTCTGCCTTTGCTGCCTAATTTGCTGCAAG[G/A]TGAGTGAAATTACTAACTTCATGTCAAAATAATGTACTGTTTCCACTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 1636 3852 35 73
Genomic Location (Zv9):
Chromosome 12 (position 19015093)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17868028
GRCz11 12 17989902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTCCACCAGCACTGCCCGCCTCGACCTGCAGTTCCAGGCTATCAAGG[T/C]GAATAACACTGAAGCGTATCCTGCTAGAATTGATTGAATGCGCTTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2201 3852 45 73
Genomic Location (Zv9):
Chromosome 12 (position 19042935)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17895321
GRCz11 12 18017195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGCAGCGGGGTATTGCAGCATGCATGACCTGTGGAAACACCAAAGTGK[T/A]AAGGGCAGTCCATTCCCTCCTGTCCAGGCTCATGAGCACCTTCCCCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2340 3852 48 73
Genomic Location (Zv9):
Chromosome 12 (position 19049868)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17902254
GRCz11 12 18024128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYAAGATGAGGCTCTCGGTTATGAATATGGAAATGAGGAARAACTTCATC[C/T]AGGTCATTCTCACTTCCCTCAKCGAGAAATCTCCCGATCCAAAGATTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 2979 3852 59 73
Genomic Location (Zv9):
Chromosome 12 (position 19080907)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17933068
GRCz11 12 18054942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCTGGAGAAACAGACTGCCGATTGTATCTGACGACCTTTCYCATTG[G/A]AGCAGCATTTTTATGTGGCGTCAGCACCATTATCAAGGTATGACAAARTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Essential Splice Site 3277 3852 66 73
Genomic Location (Zv9):
Chromosome 12 (position 19107695)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17959856
GRCz11 12 18081730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCCGGTCAGCAACAGCCCAGTTCGGCAGCWGCCCAGACGCACTCCGC[A/T]TCTGACCCGGGTCCCATTCGTGCCACGGCTCCCATGTGGCGCTGCAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122245 Nonsense 3659 3852 71 73
Genomic Location (Zv9):
Chromosome 12 (position 19126635)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17978796
GRCz11 12 18100670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTTAAAGGAATGGGCGCTGCACACTTTCCCCAATGCCACAGACTATT[G/A]GACCTTCCGCAAAATGTTCACCATCCAGCTTGCTCTAATTGGCCTAGCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link