zgc:154085

Ensembl ID:
ENSDARG00000090418
ZFIN ID:
ZDB-GENE-061110-97
Description:
WD repeat, SAM and U-box domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A0AUS0]
Human Orthologue:
WDSUB1
Human Description:
WD repeat, sterile alpha motif and U-box domain containing 1 [Source:HGNC Symbol;Acc:26697]
Mouse Orthologue:
Wdsub1
Mouse Description:
WD repeat, SAM and U-box domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919387]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40647 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40647
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121431 Essential Splice Site 225 487 3 12
ENSDART00000128024 Essential Splice Site 225 487 3 11
Genomic Location (Zv9):
Chromosome 6 (position 11923699)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11777235
GRCz11 6 12012527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGACAGTCTGCTGAAGATATGGATTGTTTCTCTTTTGCCTTCTGCAG[G/A]TAGCATCACCTTATACCCTACCCACCTGTGTCTCCTTTTCTTTCTTTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link