zgc:101673

Ensembl ID:
ENSDARG00000090403
ZFIN ID:
ZDB-GENE-041010-183
Description:
hypothetical protein LOC450060 [Source:RefSeq peptide;Acc:NP_001006080]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3221 Nonsense F2 line generated During 2018
sa24407 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3221
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102420 Nonsense 267 499 5 9
Genomic Location (Zv9):
Chromosome 23 (position 42916020)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42434939
GRCz11 23 42400435
KASP Assay ID:
554-2800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCAACATGAAGTTAAAGAACACAAAAAAACTCTGGATCCAGGMAGTCCA[C/T]GAGACTACATCGATGCCTATCTGCTGGAGATGGAGAAAGTGAGATCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102420 Nonsense 385 499 7 9
Genomic Location (Zv9):
Chromosome 23 (position 42915179)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42435780
GRCz11 23 42401276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTGGGTTGATTCATGAAACAATTCAGCCCACAAAACTACAAGGATA[C/A]GACCTTCCTCGGGTAATGAATGGAGCTTGAGTGAATGAAGCTATTTAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link