TIMP4

Ensembl ID:
ENSDARG00000090394
Description:
TIMP metallopeptidase inhibitor 4 [Source:HGNC Symbol;Acc:11823]
Human Orthologue:
TIMP4
Human Description:
TIMP metallopeptidase inhibitor 4 [Source:HGNC Symbol;Acc:11823]
Mouse Orthologue:
Timp4
Mouse Description:
tissue inhibitor of metalloproteinase 4 Gene [Source:MGI Symbol;Acc:MGI:109125]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41750 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41750
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130839 Nonsense 162 223 5 5
Genomic Location (Zv9):
Chromosome 11 (position 691796)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 674619
GRCz11 11 701117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAGTAATCTCTGAAATTGTGATCTCAACAGATATCCATCTGCACTGAA[C/T]AGCCCTGTCACCCCAAGGTAAAAAACGAGTGTATCCTGACAGACTGGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link