zgc:86896

Ensembl ID:
ENSDARG00000090369
ZFIN ID:
ZDB-GENE-040625-80
Description:
actin-related protein 2/3 complex subunit 1A [Source:RefSeq peptide;Acc:NP_001002100]
Human Orthologues:
ARPC1A, ARPC1B
Human Descriptions:
actin related protein 2/3 complex, subunit 1A, 41kDa [Source:HGNC Symbol;Acc:703]
actin related protein 2/3 complex, subunit 1B, 41kDa [Source:HGNC Symbol;Acc:704]
Mouse Orthologues:
Arpc1a, Arpc1b
Mouse Descriptions:
actin related protein 2/3 complex, subunit 1A Gene [Source:MGI Symbol;Acc:MGI:1928896]
actin related protein 2/3 complex, subunit 1B Gene [Source:MGI Symbol;Acc:MGI:1343142]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9106 Nonsense Mutation detected in F1 DNA During 2018
sa1729 Nonsense Available for shipment Available now
sa16742 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102883 Nonsense 150 357 5 10
Genomic Location (Zv9):
Chromosome 3 (position 36279807)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36151091
GRCz11 3 36280689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAAGCATATCAAGAAACCCATTAACTCCACRGTTCTAAGTCTWGACTG[G/A]CATCCCAACAACATGCTGCTGGCTGCCGGCTCTGCTGATCTCCACTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102883 Nonsense 199 357 6 10
Genomic Location (Zv9):
Chromosome 3 (position 36280035)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36151319
GRCz11 3 36280917
KASP Assay ID:
554-1674.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACCATGGGGTTCCAAAATGCCCTTTGGGGAGTTGCTTCTGGAGTAT[A/T]AGGAGTGTGGTGGCTGGGTGCACAGTGTCTGTTTCTCTCCATCTGGTGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102883 Essential Splice Site 356 357 9 10
Genomic Location (Zv9):
Chromosome 3 (position 36282879)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36154163
GRCz11 3 36283761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTYAGTAGTGTGGGCTTGGATGGTGCCATGGTTGTCTGGGATTTTAAGG[T/A]ATTTTCANTTWTTTTANNNNNNNNNAGGGATTTTAAGTCTCAATAARCAACTCAMTATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link