
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
MLLT4 (2 of 2)
- Ensembl ID:
- ENSDARG00000090354
- Description:
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 [Sour
- Human Orthologue:
- MLLT4
- Human Description:
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 [Sour
- Mouse Orthologue:
- Mllt4
- Mouse Description:
- myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 Gene
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38204 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38204
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129368 | Essential Splice Site | 29 | 400 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA655 (position 4886)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150452.1 4886 GRCz11 KN150452.1 4886 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCTCTTCCCCCTATGGATAACCACTCCAACAACAGCATGGCTATGCAGG[T/C]TAGCCTTTTTAGGAATTGAATGCATGGTATCCAGGGGCCACAGACAGTCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Metabolite levels (MHPG): Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: