
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
SHISA8 (2 of 2)
- Ensembl ID:
- ENSDARG00000090314
- Description:
- shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
- Human Orthologues:
- SHISA8, SHISA9
- Human Descriptions:
- shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
- shisa homolog 9 (Xenopus laevis) [Source:HGNC Symbol;Acc:37231]
- Mouse Orthologue:
- Shisa9
- Mouse Description:
- shisa homolog 9 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1919805]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22394 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22394
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128615 | Nonsense | 71 | 228 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 13 (position 53693517)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 24773545 GRCz11 3 24904093 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGAACCGGAAGAAATTCCAGCAGCCGGGAGCCGTTGTTGGGGTTACTA[T/A]GACGTGATGGGCCAATGGGATCCCCCGTTTAACTGTAACGCAGGAATCTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: