usp48

Ensembl ID:
ENSDARG00000090301
ZFIN ID:
ZDB-GENE-050522-197
Description:
Zgc:112364 [Source:UniProtKB/TrEMBL;Acc:Q4VBI3]
Human Orthologue:
USP48
Human Description:
ubiquitin specific peptidase 48 [Source:HGNC Symbol;Acc:18533]
Mouse Orthologue:
Usp48
Mouse Description:
ubiquitin specific peptidase 48 Gene [Source:MGI Symbol;Acc:MGI:2158502]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21958 Essential Splice Site Available for shipment Available now
sa27819 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123591 Essential Splice Site 391 1055 9 27
ENSDART00000124110 Essential Splice Site 386 515 9 13
Genomic Location (Zv9):
Chromosome 11 (position 37308680)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36205908
GRCz11 11 36467891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAATGGAGGGCAAGAAACTTCAGCTGGGCATTGAGGAAGATATCGG[T/C]AACAACACATTTTGACAACGCACCCTTTTAACACCTGTAGGTTCCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123591 Essential Splice Site 1040 1055 26 27
ENSDART00000124110   None 515 None 13
Genomic Location (Zv9):
Chromosome 11 (position 37295544)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36192772
GRCz11 11 36454755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTCATTTCTGAACATGTTTGACATTATTGTTTGTTTGTTTTTTTCA[G/A]TCTGTATGCCTGAAGAAGGATTTAAAGGTATGTTTAAGCTTAGATAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link