CDHR5 (2 of 2)

Ensembl ID:
ENSDARG00000090275
Description:
cadherin-related family member 5 [Source:HGNC Symbol;Acc:7521]
Human Orthologue:
CDHR5
Human Description:
cadherin-related family member 5 [Source:HGNC Symbol;Acc:7521]
Mouse Orthologue:
Cdhr5
Mouse Description:
cadherin-related family member 5 Gene [Source:MGI Symbol;Acc:MGI:1919290]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25373 Nonsense Mutation detected in F1 DNA During 2018
sa25372 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41048 Nonsense Mutation detected in F1 DNA During 2018
sa18896 Nonsense Mutation detected in F1 DNA During 2018
sa34204 Nonsense Mutation detected in F1 DNA During 2018
sa41047 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 8 728 1 14
Genomic Location (Zv9):
Chromosome 7 (position 58623722)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57076331
GRCz11 7 57378771
KASP Assay ID:
554-7347.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCCCACTCAACGGGCAGCACAGTCAATGCTTTATGTGAAGAAGTAC[C/T]AGCTGGTGACACGGTCTCATAGTCCTCCATGGTTATTTGTGTGTATTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Essential Splice Site 137 728 3 14
Genomic Location (Zv9):
Chromosome 7 (position 58616572)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57069181
GRCz11 7 57371621
KASP Assay ID:
554-7517.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGAGCTGACTGTCCAAGTCCGATGTAATAAAACTGGCTACAGAAGC[G/A]TAAGTTGAGTCAATTTACAGTTCAGTAAATTCTGCTCAGATGATTGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 206 728 6 14
Genomic Location (Zv9):
Chromosome 7 (position 58609991)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57062600
GRCz11 7 57365040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGACGGATTCTTTACAGAACAGATACTTCAGACTTAAGACCATGTA[T/A]ACACCAAACATCCTTGTCAACAAGGTTTTAGATTATGATGTCATCCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 218 728 6 14
Genomic Location (Zv9):
Chromosome 7 (position 58609955)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57062564
GRCz11 7 57365004
KASP Assay ID:
554-6159.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAGACCATGTATACACCAAACATCCTTGTCAACAAGGTTTTAGATTA[T/A]GATGTCATCCAGCAGGTGAAGCTGATCTTGTATGTGCAGGTATGTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 437 728 11 14
Genomic Location (Zv9):
Chromosome 7 (position 58604293)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57056902
GRCz11 7 57359342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTGTTTTTCAGGGAATCAATCCTGACATTAAATATGAAGTGCAGTA[T/A]AGCAGCTACGTTAATATCACTACAGATGGGTTTATACTTTTAAAAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 535 728 13 14
Genomic Location (Zv9):
Chromosome 7 (position 58599731)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57052340
GRCz11 7 57354780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCGGCTATCTGATATCCCGTGTCAAGAAGGGGAATTCTGACGCATTC[A/T]AGTTGTCTGAGGTCAGCATCTTCCCATCAAAGCTCAGTGAGTCCAGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link