zgc:165452

Ensembl ID:
ENSDARG00000090255
ZFIN ID:
ZDB-GENE-070719-3
Description:
hypothetical protein LOC100101638 [Source:RefSeq peptide;Acc:NP_001093612]
Human Orthologue:
PHLPP2
Human Description:
PH domain and leucine rich repeat protein phosphatase 2 [Source:HGNC Symbol;Acc:29149]
Mouse Orthologue:
Phlpp2
Mouse Description:
PH domain and leucine rich repeat protein phosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:2444928]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31616 Essential Splice Site Available for shipment Available now
sa21141 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122935 Essential Splice Site 109 207 2 5
Genomic Location (Zv9):
Chromosome 7 (position 70936716)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69072860
GRCz11 7 69252371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACAGCCTGACTGGAAAGATGCACATCTTACCCTTAGTCGGAGGGAAG[G/A]TAGGGGTCCACACACACACACACACACACACACGTTTTGCAAAAATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122935 Nonsense 173 207 4 5
Genomic Location (Zv9):
Chromosome 7 (position 70926959)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69063103
GRCz11 7 69242614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGTCTTGTGGATTTGTCCTGCTACAGTCTGGAGGAAGTGCCCGAGTA[T/A]CTGTTCTACTGCCAGGACATCACACACCTCAACCTGCGGCACAACTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link