wdr45

Ensembl ID:
ENSDARG00000090219
ZFIN ID:
ZDB-GENE-040426-990
Description:
WD repeat domain phosphoinositide-interacting protein 4 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZUX3]
Human Orthologue:
WDR45
Human Description:
WD repeat domain 45 [Source:HGNC Symbol;Acc:28912]
Mouse Orthologue:
Wdr45
Mouse Description:
WD repeat domain 45 Gene [Source:MGI Symbol;Acc:MGI:1859606]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41735 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130229 Nonsense 253 358 9 11
Genomic Location (Zv9):
Chromosome 10 (position 44129922)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42936317
GRCz11 10 42764697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTTTGCAGTATTAATTTCAGCCACGACTCCTCTTTTCTGTGCGCAT[C/A]GAGTGACAAGGGAACTGTGCACATATTTGCCCTGAAAGACACCAAACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link