ZNF518A (2 of 2)

Ensembl ID:
ENSDARG00000090188
Description:
zinc finger protein 518A [Source:HGNC Symbol;Acc:29009]
Human Orthologue:
ZNF518A
Human Description:
zinc finger protein 518A [Source:HGNC Symbol;Acc:29009]
Mouse Orthologue:
Zfp518a
Mouse Description:
zinc finger protein 518A Gene [Source:MGI Symbol;Acc:MGI:1919922]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12306 Nonsense Available for shipment Available now
sa35604 Nonsense Mutation detected in F1 DNA During 2018
sa22390 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125420 Nonsense 411 819 2 3
Genomic Location (Zv9):
Chromosome 13 (position 51481054)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50190716
GRCz11 13 50505635
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAACATAGCATTTCATCGTCAGTGATTGAGAGATGTAATAGCCAASAA[C/T]AAGATGTCTACGATAACCRGGACTTCAATAACCTCCAAYATAATCCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125420 Nonsense 636 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 51487363)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50197025
GRCz11 13 50511944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACTAAACAGAAAGCGCATGGGAGAAGAATCCTCAACAGACTCCCAA[C/T]AACAACCCGTCAGTAAATCCCCAAAGCCATCCATTCTCCATTGGGAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125420 Nonsense 670 819 3 3
Genomic Location (Zv9):
Chromosome 13 (position 51487465)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50197127
GRCz11 13 50512046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCTCGAGACACTCCGACAACCCTTCGACTGATTCCCTTCAATTCCACA[C/T]AATCCCTCAAAATCCCTGCTGAGAACCAACCCGTTATAGTCCTCAACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link