mtf1

Ensembl ID:
ENSDARG00000090180
ZFIN ID:
ZDB-GENE-020424-1
Description:
metal regulatory transcription factor 1 [Source:RefSeq peptide;Acc:NP_694513]
Human Orthologue:
MTF1
Human Description:
metal-regulatory transcription factor 1 [Source:HGNC Symbol;Acc:7428]
Mouse Orthologue:
Mtf1
Mouse Description:
metal response element binding transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101786]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45559 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126250 Essential Splice Site 399 700 7 12
ENSDART00000130571 Essential Splice Site 399 578 7 10
Genomic Location (Zv9):
Chromosome 16 (position 5147283)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4330686
GRCz11 16 4160537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGAGTCCAGAGAACAGCGTCAGCGAGGACGACCCCAAACCTACAGG[T/C]AAGATCAGTCAGGGGTTACACATTAAATCGTTTCAGCATCAATATTGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link