
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-165f21.6
- Ensembl ID:
- ENSDARG00000090099
- ZFIN ID:
- ZDB-GENE-070912-138
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S638]
- Human Orthologue:
- GIMAP8
- Human Description:
- GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
- Mouse Orthologue:
- Gimap8
- Mouse Description:
- GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12372 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12372
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000129200 | Nonsense | 84 | 411 | 2 | 2 |
ENSDART00000144876 | Nonsense | 84 | 278 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 7 (position 6390479)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 5424817 GRCz11 7 5546464 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTCTTTGAYACTGCCATCGATGAGGAGACCATTAAATCTGAGATCATT[A/T]GATCAGTGATYGAAAGCTCTCCAGGTCCAGACGTGTTCACCATCGTCCTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: