
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-233f10.4
- Ensembl ID:
- ENSDARG00000090068
- ZFIN ID:
- ZDB-GENE-060526-118
- Description:
- Uncharacterized protein C9orf117 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BDR7]
- Human Orthologue:
- C9orf117
- Human Description:
- chromosome 9 open reading frame 117 [Source:HGNC Symbol;Acc:27843]
- Mouse Orthologue:
- 1700019L03Rik
- Mouse Description:
- RIKEN cDNA 1700019L03 gene Gene [Source:MGI Symbol;Acc:MGI:2447809]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40587 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa13152 | Essential Splice Site | Available for shipment | Available now |
sa26609 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40587
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130638 | Essential Splice Site | 284 | 471 | 5 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 67676279)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 64477920 GRCz11 5 65166917 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTTAATATATCTATATCCTAGAGCAAAATAAAGTCAAAGTCTTTCTCC[A/T]GGTGGTCCTTCAGTTGACAGAAAAGTGCAAGCAAATGCAGTCTGAAGTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13152
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130638 | Essential Splice Site | 327 | 471 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 67676497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 64478138 GRCz11 5 65167135 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAAATACACCCAAGGGTGCATTTTAATAGCGTTACTCCCGCTGTATTACA[G/T]AAAGAAACATGCAGCGGTTACWGAAGACCTGAACCAAACCAAAGCTGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26609
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130638 | Nonsense | 393 | 471 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 5 (position 67676763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 64478404 GRCz11 5 65167401 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACAGGACGTCCCAGAGGAGGAAGACTCTGAGCTGAAGGTCACCGTCAGA[C/T]GAAGTCAGATGATGCAGAAGCTGCTGGCTGTTCTGGACGGCGCTGCAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: