
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000090030
- Ensembl ID:
- ENSDARG00000090030
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa28347 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa35734 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa28347
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125634 | Nonsense | 421 | 1001 | 2 | 13 |
- Genomic Location (Zv9):
- Chromosome 14 (position 37865016)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN149831.1 9401 GRCz11 4 78067574 - KASP Assay ID:
- 2260-7795.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTCCTTCCAAGTGGATACAATAATGGTGGCACTGAAGAATTTTGCAT[C/A]AATTGAAAATTTGCTTAAAGGAACAGTGGATAAAGCTCTCTGGAGTAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35734
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125634 | Nonsense | 857 | 1001 | 13 | 13 |
- Genomic Location (Zv9):
- Chromosome 14 (position 37872832)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN149831.1 1585 GRCz11 4 78047861 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTCCGACTGTCTGAAGAGAACACAAAGGTGAAGCGTGTGGGAGAGAAA[C/T]AGCCGTATCCTGATCATCCAGACAGATTTGATTATTACGCTCAGGTGTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: