ZNF473 (3 of 4)

Ensembl ID:
ENSDARG00000090020
Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Human Orthologue:
ZNF473
Human Description:
zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
Mouse Orthologue:
Zfp473
Mouse Description:
zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19632 Nonsense Available for shipment Available now
sa15139 Nonsense Available for shipment Available now
sa17136 Nonsense Available for shipment Available now
sa44518 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123441 Nonsense 57 1012 1 7
Genomic Location (Zv9):
Chromosome 1 (position 59490113)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57942078
GRCz11 1 58680870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCCAACTTGAAAAACCACGAGAGAATTCACACCGGAGAGAAACCGTA[T/G]CAGTGTTCGCACTGTCAGAAAAGTTTCGGTACTACTTCAAACTTGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123441 Nonsense 554 1012 5 7
Genomic Location (Zv9):
Chromosome 1 (position 59507033)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57958998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGTCCGAAAATTCTCTGTAATAAGAATACCCTRAAACAACACGAGTG[G/A]ATGCACACCGGAGAGCTCCCTTATCAGTGCTCGCACTGYGACAAACGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123441 Nonsense 847 1012 7 7
Genomic Location (Zv9):
Chromosome 1 (position 59514130)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57966095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAAGCACTTGAAAACCCAYGAGAGAATTCACACWGGAGAGAAACCGTA[T/G]CAGTGTTCACAYTGTCAGRAATCCTTCTCTAATTTRAACAYCTTGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123441 Nonsense 970 1012 7 7
Genomic Location (Zv9):
Chromosome 1 (position 59514497)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57966462
GRCz11 1 58681405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGGGGAAAAACCGTACACATGCTCGCACTGTGACCAGTGTTTCACA[C/T]GACCAGACACTCTTCGCAATCATGAGCGAATTCACACAGGGGAAAAACCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link