
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ZNF473 (3 of 4)
- Ensembl ID:
- ENSDARG00000090020
- Description:
- zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
- Human Orthologue:
- ZNF473
- Human Description:
- zinc finger protein 473 [Source:HGNC Symbol;Acc:23239]
- Mouse Orthologue:
- Zfp473
- Mouse Description:
- zinc finger protein 473 Gene [Source:MGI Symbol;Acc:MGI:2442697]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19632 | Nonsense | Available for shipment | Available now |
sa15139 | Nonsense | Available for shipment | Available now |
sa17136 | Nonsense | Available for shipment | Available now |
sa44518 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19632
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123441 | Nonsense | 57 | 1012 | 1 | 7 |
- Genomic Location (Zv9):
- Chromosome 1 (position 59490113)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 57942078 GRCz11 1 58680870 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTCCAACTTGAAAAACCACGAGAGAATTCACACCGGAGAGAAACCGTA[T/G]CAGTGTTCGCACTGTCAGAAAAGTTTCGGTACTACTTCAAACTTGAATCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15139
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123441 | Nonsense | 554 | 1012 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 1 (position 59507033)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 57958998 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTGTCCGAAAATTCTCTGTAATAAGAATACCCTRAAACAACACGAGTG[G/A]ATGCACACCGGAGAGCTCCCTTATCAGTGCTCGCACTGYGACAAACGTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17136
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123441 | Nonsense | 847 | 1012 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 1 (position 59514130)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 57966095 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAAAGCACTTGAAAACCCAYGAGAGAATTCACACWGGAGAGAAACCGTA[T/G]CAGTGTTCACAYTGTCAGRAATCCTTCTCTAATTTRAACAYCTTGAAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44518
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000123441 | Nonsense | 970 | 1012 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 1 (position 59514497)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 57966462 GRCz11 1 58681405 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACAGGGGAAAAACCGTACACATGCTCGCACTGTGACCAGTGTTTCACA[C/T]GACCAGACACTCTTCGCAATCATGAGCGAATTCACACAGGGGAAAAACCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: