ENSDARG00000089998

Ensembl ID:
ENSDARG00000089998

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11192 Nonsense Available for shipment Available now
sa45349 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114704 Nonsense 256 1484 5 29
Genomic Location (Zv9):
Chromosome 9 (position 13593804)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13346369
GRCz11 9 13317572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGYGAGGAWAGCCATCARCACATGCCATACTCAGATCATTCCWWCCCCA[G/T]AGACAGAAACAGCWCTCAATCAGACTGAAGATGAAGCCGTGACTTTRGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114704 Nonsense 595 1484 11 29
Genomic Location (Zv9):
Chromosome 9 (position 13582519)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 13335084
GRCz11 9 13306287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATCCCACAGTTGACACTGAGGACCACCCAATAATGGCTGAAGCCACA[C/T]AGGCTAACGGTAATCAGGGTTTTACCTGCTTTTACTCTGTGCTCAAGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link