syne1a

Ensembl ID:
ENSDARG00000089890
ZFIN ID:
ZDB-GENE-030131-4172
Description:
Novel protein similar to vertebrate spectrin repeat containing, nuclear envelope 1 (SYNE1) [Source:U
Human Orthologue:
ACTN4
Human Description:
actinin, alpha 4 [Source:HGNC Symbol;Acc:166]
Mouse Orthologue:
Actn4
Mouse Description:
actinin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1890773]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31045 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa43446 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa17206 Nonsense Available for shipment Available now
sa3056 Nonsense F2 line generated During 2018
sa5674 Nonsense F2 line generated During 2018
sa32292 Essential Splice Site Available for shipment Available now
sa37038 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Essential Splice Site 116 1551 None 35
ENSDART00000135213 Missense 117 1277 4 28
ENSDART00000063385 Essential Splice Site 116 1551 None 35
ENSDART00000135213 Missense 117 1277 4 28
Genomic Location (Zv9):
Chromosome 20 (position 26147298)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26218601
GRCz11 20 26117691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTCGCCAATGTTGGAAGAGCGCTCAAGTTTCTGGAGGGCAGAAGGG[T/C]AAGGCAGTCCATTCCCACAGTGCTTTTTGCTCAGGTGTACGGCTCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Essential Splice Site 116 1551 None 35
ENSDART00000135213 Missense 117 1277 4 28
ENSDART00000063385 Essential Splice Site 116 1551 None 35
ENSDART00000135213 Missense 117 1277 4 28
Genomic Location (Zv9):
Chromosome 20 (position 26147298)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26218601
GRCz11 20 26117691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTCGCCAATGTTGGAAGAGCGCTCAAGTTTCTGGAGGGCAGAAGGG[T/C]AAGGCAGTCCATTCCCACAGTGCTTTTTGCTCAGGTGTACGGCTCCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Nonsense 479 1551 14 35
ENSDART00000135213 Nonsense 466 1277 12 28
Genomic Location (Zv9):
Chromosome 20 (position 26226958)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26298261
GRCz11 20 26197351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTTGTGCAGGAGATCTTAAGGCTTCTTGAAAGACACAAACAGACCT[T/A]GCAGTTAATACACCGMGACAGATGTGTTAATAATATGCCTATTCCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3056
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Nonsense 1265 1551 30 35
ENSDART00000135213 Nonsense 1252 1277 28 28
ENSDART00000063385 Nonsense 1265 1551 30 35
ENSDART00000135213 Nonsense 1252 1277 28 28
Genomic Location (Zv9):
Chromosome 20 (position 26243351)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26314654
GRCz11 20 26213744
KASP Assay ID:
554-2633.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTTTTCTCTTCTGTCTGACCTTCCACAGCAAAATCTGAAGACCCAG[C/T]AAGGGAAAGATAYGGATGTGAGATGTCAAGGTAATTTCTTTAAAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5674
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Nonsense 1265 1551 30 35
ENSDART00000135213 Nonsense 1252 1277 28 28
ENSDART00000063385 Nonsense 1265 1551 30 35
ENSDART00000135213 Nonsense 1252 1277 28 28
Genomic Location (Zv9):
Chromosome 20 (position 26243351)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26314654
GRCz11 20 26213744
KASP Assay ID:
554-2633.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTTTTCTCTTCTGTCTGACCTTCCACAGCAAAATCTGAAGACCCAG[C/T]AAGGGAAAGATAYGGATGTGAGATGTCAAGGTAATTTCTTTAAAGAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Essential Splice Site 1290 1551 None 35
ENSDART00000135213   1277 1277 None 28
Genomic Location (Zv9):
Chromosome 20 (position 26243430)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26314733
GRCz11 20 26213823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTAATTTCTTTAAAGAAGACCGGGCAGCTCAAGAGAAACACCTGCAGG[T/C]GAGGCTTTTAGCACAATAATGGTATTCATACATTTGACCTGCCGTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063385 Essential Splice Site 1337 1551 31 35
ENSDART00000135213   None 1277 None 28
Genomic Location (Zv9):
Chromosome 20 (position 26246383)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 26317686
GRCz11 20 26216776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTTCAGCAGCCTCGACAACCTCAAGTCGGAAAGGAATAATATTCAA[G/A]TAAGAGCACAAACAAATAAAATATACAGTAGTAGCTACATGTTTAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link