sf3b3

Ensembl ID:
ENSDARG00000089880
ZFIN ID:
ZDB-GENE-040426-2901
Description:
Splicing factor 3B subunit 3 [Source:UniProtKB/Swiss-Prot;Acc:Q1LVE8]
Human Orthologue:
SF3B3
Human Description:
splicing factor 3b, subunit 3, 130kDa [Source:HGNC Symbol;Acc:10770]
Mouse Orthologue:
Sf3b3
Mouse Description:
splicing factor 3b, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1289341]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45636 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45636
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122831 Essential Splice Site 1088 1217 None 26
ENSDART00000147743 Essential Splice Site 1088 1217 None 27

The following transcripts of ENSDARG00000089880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 18337393)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18565937
GRCz11 18 18555003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAAAGCATTGTGGGACAGAGGCTTGCTTAACGGAGCTTCACAGAAGG[T/G]ATACGTTTCTACTACCCTCAATTTCTCATTTCCCACAGGTCCCGGAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link