
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
B8LFE8_DANRE
- Ensembl ID:
- ENSDARG00000089878
- Description:
- NEDD9 [Source:UniProtKB/TrEMBL;Acc:B8LFE8]
- Human Orthologue:
- NEDD9
- Human Description:
- neural precursor cell expressed, developmentally down-regulated 9 [Source:HGNC Symbol;Acc:7733]
- Mouse Orthologue:
- Nedd9
- Mouse Description:
- neural precursor cell expressed, developmentally down-regulated gene 9 Gene [Source:MGI Symbol;Acc:M
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23415 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23415
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125673 | Nonsense | 561 | 783 | 5 | 7 |
ENSDART00000126530 | Nonsense | 561 | 783 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 19 (position 4273938)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 3762322 GRCz11 19 3703220 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTATCGCACGACAAAGCCAACATGAACAGCGAGAAGTGCGTTAAGAGCTG[G/A]ATGGATGATTATGACTACGTTCATCTCCAGGTAGAAATCACTTTAAAAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- HIV-1 viral setpoint: Genomewide association study for determinants of HIV-1 acquisition and viral set point in HIV-1 serodiscordant couples with quantified virus exposure. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: