si:dkey-51d8.1

Ensembl ID:
ENSDARG00000089852
ZFIN ID:
ZDB-GENE-081103-14

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6953 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6953
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108891 Nonsense 577 906 4 12
ENSDART00000143150   None 738 None 6
Genomic Location (Zv9):
Chromosome 4 (position 50759484)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 44255333
GRCz11 4 45022781
KASP Assay ID:
554-4872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGAAGTCCATCTATTAGCCCAAAGATGAAACTAANNNNNTGGTCAAAGGTTA[T/A]ATAAATGTAAGCCTTTTCTAGTGCTTCTGAAAAGCATTTTATTTATTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link