
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-77l8.1
- Ensembl ID:
- ENSDARG00000089833
- ZFIN ID:
- ZDB-GENE-091118-116
- Human Orthologue:
- ASB13
- Human Description:
- ankyrin repeat and SOCS box-containing 13 [Source:HGNC Symbol;Acc:19765]
- Mouse Orthologue:
- Asb13
- Mouse Description:
- ankyrin repeat and SOCS box-containing 13 Gene [Source:MGI Symbol;Acc:MGI:2145525]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34319 | Nonsense | Available for shipment | Available now |
hu2546 | Nonsense | Confirmed mutation in F2 line | Unknown |
sa34320 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34319
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126824 | Nonsense | 66 | 294 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11562135)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 11106989 GRCz11 8 11144694 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTCAACATTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTG[T/A]ATTCAGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGATGCTGGAGCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- hu2546
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Unknown
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126824 | Nonsense | 68 | 294 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11562139)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 11106985 GRCz11 8 11144690 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAACATTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTGTATT[C/T]AGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGATGCTGGAGCTCATGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34320
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126824 | Nonsense | 276 | 294 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 8 (position 11569945)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 11099179 GRCz11 8 11136884 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCTCGGGAAAAGAGCGCTGGGGGTTTTCACTCAACTGGGACTCCCAAAC[C/T]GAATCATCTGGTTCCTCTCTTATTTACCGGCTCCTCCTATGGAGCTCCTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: